Hopkins Dome.gif (1144 bytes)

Back to
Hopkins
Pancreas
Home

 

 

 

 

 

Oncology Center Building2.JPG (30660 bytes)

The Genetics of Pancreatic Cancer

-- Technical Section

 

The People

Bibliography

You
Can Help!



DPC4 Primers

EXON 1

5’ END, DPC4S1, CGTTAGCTGTTGTTTTTCACTG

3’ END, DPC4AS1, AGAGTATGTGAAGAGATGGAG

Seq primer, DPC4Ex1, TTTCCAAAGGATCAAAATTGCTTCAG

 

EXON 2

5’ END, DPC4S2, TGTATGACATGGCCAAGTTAG

3’ END, DPC4AS2, CAATACTCGGTTTTAGCAGTC

Seq primer, DPC4Ex2, TAATACTGAGTTGGTAGGATTGTGAG

 

EXON 3

5’ END, DPC4S3, CTGAATTGAAATGGTTCATGAAC

3’ END, DPC4AS3, GCCCCTAACCTCAAAATCTAC

Seq primer, DPC4Ex3, CTCACACAAACTAATTCTAGGTCAAC

 

EXON 4

5’ END, DPC4S4, TTTTGCTGGTAAAGTAGTATGC

3’ END, DPC4AS4, CTATGAAAGATAGTACAGTTAC

Seq primer, DPC4Ex4, GGAGTTTCCCCCCAAGTGACTAC

 

EXONs 5-6

5’ END, DPC4S5/6, CATCTTTATAGTTGTGCATTATC

3’ END, DPC4AS5/6 TAATGAAACAAAATCACAGGATG

Seq primer, exon 5, DPC4Ex5, TGAAATCATAAGATGACATCTATGAATG

Seq primer, exon 6, DPC4Ex6/1, CTGGACTGGAAGTAGGACTG and

      DPC4Ex6/2, TCCGGGATGGGGCGGCATAG

 

EXON 7

5’ END, DPC4S7, TGAAAGTTTTAGCATTAGACAAC

3’ END, DPC4AS7, TGTACTCATCTGAGAAGTGAC

Seq primer, DPC4Ex7, CACTAAATCAATCTAAATACAGGAAATC

 

EXON 8

5’ END, DPC4S8, TGTTTTGGGTGCATTACATTTC

3’ END, DPC4AS8, CAATTTTTTAAAGTAACTATCTGA

Seq primer, DPC4Ex8, TGTGTTGTGGAGTGCAAGTGAAAG

 

EXON 9

5’ END, DPC4S9, TATTAAGCATGCTATACAATCTG

3’ END, DPC4AS9, CTTCCACCCAGATTTCAATTC

Seq primer, DPC4Ex9, TTTTGACAACAAATAGAGCTTTAAGTC

 

EXON 10

5’ END, DPC4S10, AGGCATTGGTTTTTAATGTATG

3’ END, DPC4AS10, CTGCTCAAAGAAACTAATCAAC

Seq primer, DPC4Ex10, GAATTTTCTTTATGAACTCATAG

 

EXON 11

5’ END, DPC4S11, CCAAAAGTGTGCAGCTTGTTG

3’ END, DPC4AS11, CAGTTTCTGTCTGCTAGGAG

Seq primer, DPC4Ex11, TATTTTGTAGTCCACCATC